Enter the primers you want to display. An example primer entry is: (T7) aatacgactcactatag. The round brackets surround the name of the primer; the sequence is written 5' to 3'; Multiple entries are separated by commas.
(reverse) aacagctatgaccatg, (T3) attaaccctcactaaag, (KS) cgaggtcgacggtatcg, (SK) tctagaactagtggatc, (T7) aatacgactcactatag, (-40) gttttcccagtcacgac, (Sp6) atttaggtgacactatag, (M13 for) gtaaaacgacggccagt, (M13 rev) cacacaggaaacagctatgaccat, (BGH rev) tagaaggcacagtcgagg, (pGEX for) ctggcaagccacgtttggtg, (pGEX rev) ggagctgcatgtgtcagagg, (T7-EEV aaggctagagtacttaatacga, (pUC/M13 Forward) gttttcccagtcacgac, (pUC/M13 forward) cgccagggttttcccagtcacgac, (pUC/M13 reverse) caggaaacagctatgac, (pUC/M13 reverse) tcacacaggaaacagctatgac, (Glprimer1) tgtatcttatggtactgtaactg, (GLprimer2) ctttatgtttttggcgtcttcca, (RVprimer3) ctagcaaaataggctgtccc, (RVprimer4) gacgatagtcatgccccgcg, (Lambda gt11 Forward) ggtggcgacgactcctggagcccg, (Lambda gt11 Reverse) ttgacaccagaccaactggtaatg, (Lambda gt10 Forward) cttttgagcaagttcagcctggttaag, (lambda gt10 Reverse) gaggtggcttatgagtatttcttccagggta, (Pinpoint Sequencing) cgtgacgcggtgcagggcg, (pTarget Sequencing) ttacgccaagttatttaggtgaca
Bases per line: 105 90 75 60 45 30
Reading frame: 1 2 3 1, 2, and 3 uppercase text none Genetic code: standard (1) vertebrate mitochondrial (2) yeast mitochondrial (3) mold mitochondrial (4) invertebrate mitochondrial (5) ciliate nuclear (6) echinoderm mitochondrial (9) euplotid nuclear (10) bacterial (11) alternative yeast nuclear (12) ascidian mitochondrial (13) flatworm mitochondrial (14) Blepharisma macronuclear (15) chlorophycean mitochondrial (16) trematode mitochondrial (21) Scenedesmus obliquus mitochondrial (22) Thraustochytrium mitochondrial (23)
Restriction sites: be shown not be shown long cutters (>5 bp) long cutter (>5 bp) without isoschizomers short cutters (<=5 bp) short cutters (<=5 bp) without isoschizomers
Sequences: linear circular
Paste the sequences either as raw data (IUPAC code) or as one or more FASTA sequences. Input limit is 100000 characters.
Powered by The Sequence Manipulation Suite.
